logo eduetka

WebQuest

GENETICA BACTERIANA

Introducción

En esta actividad aplicarás los conocimientos adquiridos en tu clase de Microbiología, en la unidad IV Genética Bacteriana. Aplicarás los conceptos de :

  • Replicación de DNA

  • Transcripción

  • Traducción 

Area y Asignatura

Ciencias Naturales - Biología

Edad

  • No hay restriccion de edad

Herramientas

  • Audio
  • Auto Aplicaciones
  • Blogs
  • Fotografía
  • Infografías

Tarea

 

 

 

De la siguiente secuencia completa las bases complementarias de acuerdo a como lo haría la enzima ____________ en la Replicación.

Identifica  cual sería la cadena continua y cual sería la cadena discontinua.

 

3´TTGACCGATGACCCCGGTTCAGGCTTCACCACAGTGTGGAACGCGGTCGTCTCCGAACTTAACGGCGACC 5´

 

 

 

5´CTAAGGTTGACGACGGACCCAGCAGTGATGCTAATCTCAGCGCTCCGCTGACCCCTCAGCAAAGGGCTTG 3´
 





?De la siguiente secuencia identifica los sitios promotores en donde se uniría la enzima ______________ en la Transcripcion. 


GCTCAATCTCGTCCAGCCATTGACCATCGTCGAGGGGTTTGCTCTGTTATCCGTGCCGAGCAGCTTTGTC
CAAAACGAAATCGAGCGCCATCTGCGGGCCCCGATTACCGACGCTCTCAGCCGCCGACTCGGACATCAGA
TCCAACTCGGGGTCCGCATCGCTCCGCCGGCGACCGACGAAGCCGACGACACTACCGTGCCGCCTTCCGA
AAATCCTGCTACCACATCGCCAGACACCACAACCGACAACGACGAGATTGATGACAGCGCTGCGGCACGG
GGCGATAACCAGCACAGTTGGCCAAGTTACTTCACCGAGCGCCCGCACAATACCGATTCCGCTACCGCTG
GCGTAACCAGCCTTAACCGTCGCTACACCTTTGATACGTTCGTTATCGGCGCCTCCAACCGGTTCGCGCA
CGCCGCCGCCTTGGCGATCGCAGAAGCACCCGCCCGCGCTTACAACCCCCTGTTCATCTGGGGCGAGTCC
GGTCTCGGCAAGACACACCTGCTACACGCGGCAGGCAACTATGCCCAACGGTTGTTCCCGGGAATGCGGG
TCAAATATGTCTCCACCGAGGAATTCACCAACGACTTCATTAACTCGCTCCGCGATGACCGCAAGGTCGC
ATTCAAACGCAGCTACCGCGACGTAGACGTGCTGTTGGTCGACGACATCCAATTCATTGAAGGCAAAGAG
GGTATTCAAGAGGAGTTCTTCCACACCTTCAACACCTTGCACAATGCCAACAAGCAAATCGTCATCTCAT
CTGACCGCCCACCCAAGCAGCTCGCCACCCTCGAGGACCGGCTGAGAACCCGCTTTGAGTGGGGGCTGAT
CACTGACGTACAACCACCCGAGCTGGAGACCCGCATCGCCATCTTGCGCAAGAAAGCACAGATGGAACGG
CTCGCGGTCCCCGACGATGTCCTCGAACTCATCGCCAGCAGTATCGAACGCAATATCCGTGAACTCGAGG
GCGCGCTGATCCGGGTCACCGCGTTCGCCTCATTGAACAAAACACCAATCGACAAAGCGCTGGCCGAGAT
TGTGCTTCGCGATCTGATCGCCGACGCCAACACCATGCAAATCAGCGCGGCGACGATCATGGCTGCCACC
GCCGAATACTTCGACACTACCGTCGAAGAGCTTCGCGGGCCCGGCAAGACCCGAGCACTGGCCCAGTCAC
GACAGATTGCGATGTACCTGTGTCGTGAGCTCACCGATCTTTCGTTGCCCAAAATCGGCCAAGCGTTCGG
CCGTGATCACACAACCGTCATGTACGCCCAACGCAAGATCCTGTCCGAGATGGCCGAGCGCCGTGAGGTC
TTTGATCACGTCAAAGAACTCACCACTCGCATCCGTCAGCGCTCCAAGCGCTAGCACGGCGTGTTCTTCC
GACAACGTTCTTAAAAAAACTTCTCTCTCCCAGGTCACACCAGTCACAGAGATTGGCTGTGAGTGTCGCT
GTGCACAAACCGCGCACAGACTCATACAGTCCCGGCGGTTCCGTTCACAACCCACGCCTCATCCCCACCG
ACCCAACACACACCCCACAGTCATCGCCACCGTCATCCACAACTCCGACCGACGTCGACCTGCACCAAGA
CCAGACTGTCCCCAAACTGCACACCCTCTAATACTGTTACCGAGATTTCTTCGTCGTTTGTTCTTGGAAA
GACAGCGCTGGGGATCGTTCGCTGGATACCACCCGCATAACTGGCTCGTCGCGGTGGGTCAGAGGTCAAT
GATGAACTTTCAAGTTGACGTGAGAAGCTCTACGGTTGTTGTTCGACTGCTGTTGCGGCCGTCGTGGCGG
GTCACGCGTCATGGGCATTCGTCGTTGGCAGTCCCCACGCTAGCGGGGCGCTAGCCACGGGATCGAACTC
ATCGTGAGGTGAAAGGGCGCAATGGACGCGGCTACGACAAGAGTTGGCCTCACCGACTTGACGTTTCGTT
TGCTACGAGAGTCTTTCGCCGATGCGGTGTCGTGGGTGGCTAAAAATCTGCCAGCCAGGCCCGCGGTGCC
GGTGCTCTCCGGCGTGTTGTTGACCGGCTCGGACAACGGTCTGACGATTTCCGGATTCGACTACGAGGTT
TCCGCCGAGGCCCAGGTTGGCGCTGAAATTGTTTCTCCTGGAAGCGTTTTAGTTTCTGGCCGATTGTTGT

De la siguiente secuencia DNA molde  transcribe a RNA mensajero 

y ejemplifica la traducción de los tripletes de acuerdo al código genético, en los aminoácidos correspondientes.

3 ´GGTCTCGGCAAGACACACCTGCTACACGCGGCAGGCAACTATGCCCAACGGTTGTTCCCGGGAATGCGGG 5´
 
 
 
 

 

Procesos

El alumno :

  • Analizará los conceptos básicos de Genética Bacteriana.
  • Aplicará los procesos moleculares de Replicación, Transcripción y Traducción en ejemplos de secuencias.
  • Reconocerá las enzimas que participan en los procesos moleculares.

Recursos

Evaluación

 

EVALUACIÓN DE ACTIVIDAD DE APRENDIZAJE
  NO ACEPTABLE ACEPTABLE BUENO

 EJERCICIO DE REPLICACIÓN

DEL DNA  

Comprensión deficiente del tema y los conceptos. No integra el conocimiento, más de dos respuestas son erroneas. Comprende los conceptos, los memoriza pero tiene dificultad para aplicarlos en la resolución del problema. Uno o dos resultados son erróneos Comprende los conceptos de Replicación, integra perfectamente el conocimiento en la resolución del problema y resuelve con respuesta correcta en cada caso.

 

 

     

 

 

 

 

Notas

MTRA. ISABEL MARTÍNEZ SANABRIA

MICROBIOLOGÍA

Créditos

Autor:

Proyecto creado por Isabel Martinez Sanabria - utilizando a eduteka.org

Fecha de publicación: 2013-10-25 01:39:51
Responsive image

*Nota: toda la información que aparece en los Proyectos de Clase y WebQuest del portal educativo Eduteka es creada por los usuarios del portal.